Esta es nuestra última selección de publicaciones y patentes mundiales en inglés sobre Biodiversidad, entre muchas revistas científicas en línea, clasificadas y centradas en biodiversidad, diversidad de especies, diversidad de ecosistemas, diversidad genética, nivel trófico, especies clave, biogeografía, endemismo, desarrollo sostenible, especies invasoras, bioma, factor abiótico, nicho ecológico y factor biótico.
Xdh nucleic acid-targeted oligonucleotide and use thereof
Patent published on the 2026-05-21 in WO under Ref WO2026102761 by SICAGENE BIOSCIENCE CO LTD [CN] (Wang Haisheng [cn], Lai Fan [cn], Dang Yunkun [cn], Wang Xiaolei [cn], Wang Yuhang [cn], Yu Xiaohua [cn], Cong Dezi [cn], Chen Huan [cn])
Abstract: The present invention relates to the field of biomedicine, and specifically relates to an XDH nucleic acid-targeted oligonucleotide and a use thereof. The oligonucleotide contains consecutive sequences that are at least 80%, 90%, 95%, 99%, or 100% identical to at least 12 consecutive nucleotides in a sequence GCCCACCATGTCC TCCTCAGACTGACCCTT, TGCCCAACACAAGTAACCTAG, or TTGCCACAAGGTGTCAGTATATGT. The oligonucleotide or the modified oligonucleotide can be used for treating XDH-related diseases or sym[...]
Our summary: The invention describes an XDH nucleic acid-targeted oligonucleotide. It consists of sequences with high identity to specific nucleotides. The oligonucleotide is intended for treating XDH-related diseases or symptoms.
XDH, oligonucleotide, biomedicine, nucleic acid
Patent
Leveraging circulating oral microbiome vesicle-associated proteins for the diagnosis and prognosis of mixed dementias
Patent published on the 2026-05-20 in EP under Ref EP4745575 by UNIV LLEIDA [ES] (Serra Maqueda Aida [es], Gallart Palau Xavier [es], Mulet MarÍa [es], SÁnchez MilÁn Jose Antonio [es])
Abstract: The present invention refers to the use of an oral microbiome-derived extracellular vesicle associated protein (OMEVP) in the diagnosis or prognosis of mixed dementias in a biological sample obtained from a subject, wherein the OMEVP is the Chaperone protein DnaK or a fragment thereof. Furthermore, the present inventions refers to the method of diagnosis or prognosis of mixed dementia in a subject comprising assessing the level of an OMEVP in a biological sample obtained from a subject.[...]
Our summary: This invention utilizes oral microbiome-derived extracellular vesicle proteins for diagnosing mixed dementias. It specifically focuses on the Chaperone protein DnaK or its fragments. The method involves assessing OMEVP levels in biological samples from subjects.
microbiome, dementia, extracellular vesicles, diagnosis
Patent
Two treatments of birdsong awareness and their influence on human mental well-being in an urban park environment
Published on 2026-05-14 by @OXFORD
Abstract: AbstractGoing outside for a bird or nature walk has a positive impact on people’s well-being. In a quasi-experimental setting, we compared verbal and visual guidance related to birdsong regarding their effects on mental well-being, physiological stress parameters, and the subjective experience of nature. A total of 47 people participated in a study conducted in the controlled environment of an arboretum within a botanical garden. We applied two interventions in a pre-post design: 20 participan[...]
Our summary: The study examines the effects of verbal and visual guidance on birdsong awareness and its impact on human mental well-being in an urban park. Results indicate that both treatments positively influenced mental well-being and reduced physiological stress parameters. Participants with greater bird knowledge and nature experience reported enhanced mental well-being and perception of biodiversity.
birdsong, mental well-being, urban park, physiological stress
Publication
Ecg electrode with retention feature
Patent published on the 2026-05-14 in AU under Ref AU2024390405 by KPR U S LLC (Beaulieu Kevin, Garstka Erick, Chu Michael, Lawlor Garrett)
Abstract: A biomedical electrode, and in particular an electrocardiogram (ECG) electrode, has one or more retention features for retaining a connector of a lead wire on the electrode. A retention member of a stud of the electrode includes a first retainer for engaging and retaining a first type of connector to the stud and a second retainer for engaging and retaining a second type of connector to the stud, where the first and second types of connectors having different connection methods.[...]
Our summary: The ECG electrode includes retention features for securing lead wire connectors. It has a retention member with two types of retainers for different connector types. This design enhances compatibility and stability for various ECG applications.
ECG electrode, retention feature, biomedical electrode, connector compatibility
Patent
lactobionic acid, trehalose, and rhamnose
Patent published on the 2026-05-13 in EP under Ref EP4740934 by SKYLAB AG [CH] (Belous Elena [ru], Ivanova Angelina [gb])
Abstract: [0001] The invention relates to a hair care and/or scalp care composition comprising rhamnose, trehalose and lactobionic acid. Said composition moisturizes the scalp, protects the scalp from dehydration, promotes the growth of Staphylococcus epidermis and/or Cutibacterium acnes on the scalp and can be used for treating or preventing dandruff.[...]
Our summary: The composition includes rhamnose, trehalose, and lactobionic acid for hair and scalp care. It moisturizes the scalp and protects against dehydration. Additionally, it promotes beneficial bacteria growth and can help treat or prevent dandruff.
lactobionic acid, trehalose, rhamnose, hair care
Patent
Intelligent health management systems and methods with real-time data integration and personalized reporting
Patent published on the 2026-05-07 in US under Ref US20260128141 by NG WEE LIP [MY] (Quah Kian Hong [us], Ng Wee Lip [my])
Abstract: [0000] A method for intelligent health management with real-time data integration and personalized reporting includes the steps of: collecting user-specific data from a plurality of sources, wherein the user-specific data comprises biometric data, clinical data, psychological data, lifestyle data, and social support data; processing the collected data using a hybrid AI engine that integrates quantitative analytical methods with large language models (LLMs); generating a reconfigurable hierarchic[...]
Our summary: The method involves collecting user-specific data from various sources, processing it with a hybrid AI engine, and generating personalized health reports. It creates a dynamic decision matrix that adjusts in real-time based on new data and user inputs. The system aims to provide actionable insights and individualized recommendations for better health outcomes.
health management, real-time data, personalized reporting, hybrid AI
Patent
Artificial intelligence patient guidance system for injectable medication administration
Patent published on the 2026-05-07 in US under Ref US20260124382 by DATADOSE LLC [US] (Corbett Jeremy [us])
Abstract: [0000] An AI patient guidance system for injectable medication administration combines intelligent injection devices with artificial intelligence guidance modules to provide real-time instructions for proper injection technique. The system includes intelligent injection devices that administer medication and collect administration data including injection completion status, dosage volume, administration timing, or patient biometric data, or AI guidance modules that provide real-time instructions[...]
Our summary: The system integrates intelligent injection devices with AI modules for real-time guidance on injection techniques. It adapts instructions based on patient skill level and medication type while collecting administration data. Enhanced accuracy and compliance are achieved through personalized guidance and adaptive learning.
AI guidance, injectable medication, patient compliance, machine learning
Patent
Global biodiversity research requires sustained investment in local scientific infrastructure and capacities
Published on 2026-05-06 by Luis R. Rivas, Viador Pinto Aez, Randy L. Powell, Cord B. Eversole @NATURE npj
Abstract: npj Biodiversity, Published online: 06 May 2026; doi:10.1038/s44185-026-00128-7Biodiversity research remains shaped by extractive models, leaving local capacity underdeveloped. We present a framework for local biodiversity infrastructure, that offers a model for under-resourced regions worldwide. Our framework includes five structural components that enable sustainable institutions. These components strengthen regional capacity and redirect resources toward sustained, nationally grounded systems[...]
Our summary: Global biodiversity research needs investment in local scientific infrastructure. A framework for local biodiversity infrastructure is proposed to support under-resourced regions. This model enhances regional capacity and promotes sustainable, impactful research.
biodiversity, research infrastructure, local capacity, sustainable systems
Publication











